Transcript: Human XM_011521614.3

PREDICTED: Homo sapiens myosin IXA (MYO9A), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
MYO9A (4649)
Length:
12493
CDS:
288..8204

Additional Resources:

NCBI RefSeq record:
XM_011521614.3
NBCI Gene record:
MYO9A (4649)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011521614.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000415433 AGAAGTCCAGACTCGTTTATC pLKO_005 1249 CDS 100% 13.200 18.480 N MYO9A n/a
2 TRCN0000432163 CGAAAGTCTGGTTCGACTAAT pLKO_005 6795 CDS 100% 13.200 18.480 N MYO9A n/a
3 TRCN0000156714 GCCCAGTTTCAGGCATCATTA pLKO.1 2961 CDS 100% 13.200 10.560 N MYO9A n/a
4 TRCN0000428376 GAACTAGAGCAAGCTATATTT pLKO_005 4122 CDS 100% 15.000 10.500 N MYO9A n/a
5 TRCN0000155694 CCAGAGATTCTGGAGGAATTA pLKO.1 3434 CDS 100% 13.200 9.240 N MYO9A n/a
6 TRCN0000155160 GCCTTGGCTGTTGTATTTGAA pLKO.1 8405 3UTR 100% 5.625 3.938 N MYO9A n/a
7 TRCN0000154423 GCCAAGAATTGGAGAGTGTTT pLKO.1 4892 CDS 100% 4.950 3.465 N MYO9A n/a
8 TRCN0000154740 GCCACAATTCTGATGACCTTT pLKO.1 5248 CDS 100% 4.950 3.465 N MYO9A n/a
9 TRCN0000156898 GCCATCGTTATCCAGCAGAAA pLKO.1 3588 CDS 100% 4.950 3.465 N MYO9A n/a
10 TRCN0000154465 GCTAAGACTGTATGTGCTGAA pLKO.1 8332 3UTR 100% 4.050 2.835 N MYO9A n/a
11 TRCN0000157763 CCACCCAATATAGCATCCCTA pLKO.1 6514 CDS 100% 2.640 1.848 N MYO9A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011521614.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.