Transcript: Human XM_011521625.3

PREDICTED: Homo sapiens NEDD4 E3 ubiquitin protein ligase (NEDD4), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
NEDD4 (4734)
Length:
5806
CDS:
282..2831

Additional Resources:

NCBI RefSeq record:
XM_011521625.3
NBCI Gene record:
NEDD4 (4734)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011521625.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000272425 AGTGCTACTCGCAGCTATTTA pLKO_005 3326 3UTR 100% 15.000 21.000 N NEDD4 n/a
2 TRCN0000272477 TACGTGAGAGTGACGTTATAT pLKO_005 255 5UTR 100% 15.000 21.000 N NEDD4 n/a
3 TRCN0000381909 TGCAAGCACAACGTGCATTTA pLKO_005 841 CDS 100% 13.200 18.480 N NEDD4 n/a
4 TRCN0000007554 CGGTTGGAGAATGTAGCAATA pLKO.1 1641 CDS 100% 10.800 15.120 N NEDD4 n/a
5 TRCN0000272424 CGGTTGGAGAATGTAGCAATA pLKO_005 1641 CDS 100% 10.800 15.120 N NEDD4 n/a
6 TRCN0000007551 CCGGAGAATTATGGGTGTCAA pLKO.1 1799 CDS 100% 4.950 6.930 N NEDD4 n/a
7 TRCN0000284755 CCGGAGAATTATGGGTGTCAA pLKO_005 1799 CDS 100% 4.950 6.930 N NEDD4 n/a
8 TRCN0000007552 CCGTCAAGTAACTTGGATGTT pLKO.1 987 CDS 100% 4.950 6.930 N NEDD4 n/a
9 TRCN0000007553 GCTGAACTATACGGTTCAAAT pLKO.1 2643 CDS 100% 1.320 1.848 N NEDD4 n/a
10 TRCN0000272476 GCTGAACTATACGGTTCAAAT pLKO_005 2643 CDS 100% 1.320 1.848 N NEDD4 n/a
11 TRCN0000381279 AGTTCACACAATAGGATATAA pLKO_005 3097 3UTR 100% 15.000 10.500 N NEDD4 n/a
12 TRCN0000379572 GGAAATGTTTAACCCTTATTA pLKO_005 1922 CDS 100% 15.000 10.500 N NEDD4 n/a
13 TRCN0000380668 TTGCCACCTTATGAATCATTT pLKO_005 2745 CDS 100% 13.200 9.240 N NEDD4 n/a
14 TRCN0000007550 GCCTTTCTCTTGCCTGCATAT pLKO.1 3568 3UTR 100% 10.800 7.560 N NEDD4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011521625.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.