Transcript: Human XM_011521770.1

PREDICTED: Homo sapiens multiple C2 and transmembrane domain containing 2 (MCTP2), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
MCTP2 (55784)
Length:
7497
CDS:
66..2579

Additional Resources:

NCBI RefSeq record:
XM_011521770.1
NBCI Gene record:
MCTP2 (55784)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011521770.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000428979 GAAGGTATATGATCGAGATTT pLKO_005 842 CDS 100% 13.200 18.480 N MCTP2 n/a
2 TRCN0000421895 GCAGATTACCCAGCGATATTG pLKO_005 1535 CDS 100% 13.200 18.480 N MCTP2 n/a
3 TRCN0000007119 CGTCGGCATTCTACAAGTGAA pLKO.1 1586 CDS 100% 4.950 6.930 N MCTP2 n/a
4 TRCN0000007120 CCTTATATATAATCCGGTGAA pLKO.1 1940 CDS 100% 4.050 5.670 N MCTP2 n/a
5 TRCN0000007121 CTCCTTATGTTGGTCACACTT pLKO.1 1446 CDS 100% 4.950 3.960 N MCTP2 n/a
6 TRCN0000007118 CCCTATTCCATCGACAATAAT pLKO.1 2445 CDS 100% 15.000 10.500 N MCTP2 n/a
7 TRCN0000421503 ACATGGGAGTGATCGTGTTAA pLKO_005 973 CDS 100% 13.200 9.240 N MCTP2 n/a
8 TRCN0000421406 GAACGTCTGGGCACGTGTAAA pLKO_005 1353 CDS 100% 13.200 9.240 N MCTP2 n/a
9 TRCN0000007117 CCACTTCTTCTCACTTTACTT pLKO.1 3307 3UTR 100% 5.625 3.938 N MCTP2 n/a
10 TRCN0000156019 CATGGAATACTATGCAGCCAT pLKO.1 7049 3UTR 100% 2.640 1.320 Y LOC340211 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011521770.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.