Transcript: Human XM_011521846.3

PREDICTED: Homo sapiens immunoglobulin superfamily DCC subclass member 4 (IGDCC4), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
IGDCC4 (57722)
Length:
6295
CDS:
15..3770

Additional Resources:

NCBI RefSeq record:
XM_011521846.3
NBCI Gene record:
IGDCC4 (57722)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011521846.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000424472 GGGTCATTGAAGGCAACTATT pLKO_005 352 CDS 100% 13.200 9.240 N IGDCC4 n/a
2 TRCN0000421781 TCTACTGAGGTGCGAGGAAAT pLKO_005 1740 CDS 100% 10.800 7.560 N IGDCC4 n/a
3 TRCN0000426776 TCTGACTTTAGTGCATCTAAC pLKO_005 3426 CDS 100% 10.800 7.560 N IGDCC4 n/a
4 TRCN0000073431 CCATTCACCAAATACGAGTTT pLKO.1 2460 CDS 100% 4.950 3.465 N IGDCC4 n/a
5 TRCN0000073428 CCCTGAATTAAATGGCTGTTT pLKO.1 5704 3UTR 100% 4.950 3.465 N IGDCC4 n/a
6 TRCN0000073430 GCCATTCACCAAATACGAGTT pLKO.1 2459 CDS 100% 4.050 2.835 N IGDCC4 n/a
7 TRCN0000073432 GCTTCAGCCAAACAAGGTGTA pLKO.1 1784 CDS 100% 4.050 2.835 N IGDCC4 n/a
8 TRCN0000073429 GCTTTCAACAAACATGAGGAT pLKO.1 2169 CDS 100% 2.640 1.848 N IGDCC4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011521846.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.