Transcript: Human XM_011522000.1

PREDICTED: Homo sapiens elongation factor like GTPase 1 (EFL1), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
EFL1 (79631)
Length:
3353
CDS:
630..3203

Additional Resources:

NCBI RefSeq record:
XM_011522000.1
NBCI Gene record:
EFL1 (79631)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011522000.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000236501 AGTGTATCTGAACCTATTATT pLKO_005 1890 CDS 100% 15.000 21.000 N EFL1 n/a
2 TRCN0000149847 CGCTTGATAGTGGAACTGAAA pLKO.1 503 5UTR 100% 4.950 3.960 N EFL1 n/a
3 TRCN0000236497 AGTGACTTCTTTAGGATTAAA pLKO_005 797 CDS 100% 15.000 10.500 N EFL1 n/a
4 TRCN0000236499 AGTGATTTGATTCGTTCTATG pLKO_005 2148 CDS 100% 10.800 7.560 N EFL1 n/a
5 TRCN0000236500 CACGACATTCAGACCCTAAAG pLKO_005 835 CDS 100% 10.800 7.560 N EFL1 n/a
6 TRCN0000189817 GCACGACATTCAGACCCTAAA pLKO.1 834 CDS 100% 10.800 7.560 N Efl1 n/a
7 TRCN0000236498 TGACGGGCTAATCACCATAAC pLKO_005 2048 CDS 100% 10.800 7.560 N EFL1 n/a
8 TRCN0000147924 GCAGTCATACACCAAATGAAA pLKO.1 1986 CDS 100% 5.625 3.938 N EFL1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011522000.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.