Transcript: Human XM_011522354.1

PREDICTED: Homo sapiens chloride voltage-gated channel 7 (CLCN7), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CLCN7 (1186)
Length:
4306
CDS:
367..2610

Additional Resources:

NCBI RefSeq record:
XM_011522354.1
NBCI Gene record:
CLCN7 (1186)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011522354.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000303947 ACGTCACTGAAACGAGATTTC pLKO_005 991 CDS 100% 10.800 15.120 N CLCN7 n/a
2 TRCN0000045077 CAAGGGCAATATCGACAAGTT pLKO.1 669 CDS 100% 4.950 6.930 N CLCN7 n/a
3 TRCN0000045075 CCAGCTCATCGTTCTCCTAAA pLKO.1 2238 CDS 100% 10.800 8.640 N CLCN7 n/a
4 TRCN0000045076 CTCCACGTTCACCCTGAATTT pLKO.1 1191 CDS 100% 13.200 9.240 N CLCN7 n/a
5 TRCN0000300217 CTCCACGTTCACCCTGAATTT pLKO_005 1191 CDS 100% 13.200 9.240 N CLCN7 n/a
6 TRCN0000310791 CTCCTCGTCTAGGTTTCTTTA pLKO_005 2845 3UTR 100% 13.200 9.240 N CLCN7 n/a
7 TRCN0000303886 AGTATGAGAGCTTGGACTATG pLKO_005 470 CDS 100% 10.800 7.560 N CLCN7 n/a
8 TRCN0000303885 TCAAGACGTTGGTGATCAAAG pLKO_005 863 CDS 100% 10.800 7.560 N CLCN7 n/a
9 TRCN0000045073 CCTCAAGTACAGGGTCATCAA pLKO.1 651 CDS 100% 4.950 3.465 N CLCN7 n/a
10 TRCN0000045074 CCTCATCAACTTCGGAAGGTT pLKO.1 1260 CDS 100% 3.000 2.100 N CLCN7 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011522354.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.