Transcript: Human XM_011522466.2

PREDICTED: Homo sapiens ubinuclein 1 (UBN1), transcript variant X7, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
UBN1 (29855)
Length:
3178
CDS:
514..2931

Additional Resources:

NCBI RefSeq record:
XM_011522466.2
NBCI Gene record:
UBN1 (29855)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011522466.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000235872 ATGGACTCGCTGACGGATTTG pLKO_005 438 5UTR 100% 10.800 15.120 N UBN1 n/a
2 TRCN0000017814 GCCAGCTCAATCTCCAAACAT pLKO.1 2158 CDS 100% 5.625 4.500 N UBN1 n/a
3 TRCN0000017813 CGGAAGAAGTTCCAATGGAAT pLKO.1 973 CDS 100% 4.950 3.960 N UBN1 n/a
4 TRCN0000235870 TGATGGCTTCACCCTACAAAT pLKO_005 2510 CDS 100% 13.200 9.240 N UBN1 n/a
5 TRCN0000235873 TATGCCTATCTTGCGTCATTC pLKO_005 676 CDS 100% 10.800 7.560 N UBN1 n/a
6 TRCN0000017817 CCAGAAGTACATCAGTCCAAA pLKO.1 1765 CDS 100% 4.950 3.465 N UBN1 n/a
7 TRCN0000017815 GCTCGGAAACTTCACCTCTAT pLKO.1 730 CDS 100% 4.950 3.465 N UBN1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011522466.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.