Transcript: Human XM_011522571.2

PREDICTED: Homo sapiens ribosomal protein L3 like (RPL3L), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
RPL3L (6123)
Length:
1997
CDS:
493..1731

Additional Resources:

NCBI RefSeq record:
XM_011522571.2
NBCI Gene record:
RPL3L (6123)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011522571.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000440513 TCGCCAAGCCGTGGAGAATAT pLKO_005 1575 CDS 100% 13.200 18.480 N RPL3L n/a
2 TRCN0000117539 CGTCATGCTGAAGGGTTGTAT pLKO.1 1497 CDS 100% 5.625 7.875 N RPL3L n/a
3 TRCN0000117541 GCGGGTCATTACGCTGAGAAA pLKO.1 1533 CDS 100% 4.950 6.930 N RPL3L n/a
4 TRCN0000117540 GTCATGCTGAAGGGTTGTATT pLKO.1 1498 CDS 100% 13.200 9.240 N RPL3L n/a
5 TRCN0000424159 AGCCAGAGTGAGGTCATTGAT pLKO_005 1141 CDS 100% 5.625 3.938 N RPL3L n/a
6 TRCN0000117538 CGGAGCTTCAAGACCATCTTT pLKO.1 805 CDS 100% 5.625 3.938 N RPL3L n/a
7 TRCN0000117537 CCTTGCCTGCTGCCTAGACAA pLKO.1 1852 3UTR 100% 1.650 0.990 N RPL3L n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011522571.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.