Transcript: Human XM_011522614.3

PREDICTED: Homo sapiens lipase maturation factor 1 (LMF1), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
LMF1 (64788)
Length:
1887
CDS:
4..1626

Additional Resources:

NCBI RefSeq record:
XM_011522614.3
NBCI Gene record:
LMF1 (64788)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011522614.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000436572 CTTCACATCGTCAACACTTAC pLKO_005 1201 CDS 100% 10.800 8.640 N LMF1 n/a
2 TRCN0000438372 GGCCATGTCTGGTACTCTTTC pLKO_005 496 CDS 100% 10.800 7.560 N LMF1 n/a
3 TRCN0000437712 TTGGAGCAGGCCTGATCAAGA pLKO_005 659 CDS 100% 4.950 3.465 N LMF1 n/a
4 TRCN0000172638 GCATGGACTTCCACTATGAGA pLKO.1 713 CDS 100% 3.000 2.100 N LMF1 n/a
5 TRCN0000172884 GATGGACTGGTCAGACATGAA pLKO.1 351 CDS 100% 4.950 2.970 N LMF1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011522614.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.