Transcript: Human XM_011522764.2

PREDICTED: Homo sapiens RAB11 family interacting protein 3 (RAB11FIP3), transcript variant X5, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
RAB11FIP3 (9727)
Length:
3303
CDS:
182..1657

Additional Resources:

NCBI RefSeq record:
XM_011522764.2
NBCI Gene record:
RAB11FIP3 (9727)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011522764.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000423236 CATTGCTGACAAGGTTGTCTT pLKO_005 769 CDS 100% 4.950 6.930 N RAB11FIP3 n/a
2 TRCN0000056476 CACTTTGAGGACTACGGTGAA pLKO.1 416 CDS 100% 4.050 5.670 N RAB11FIP3 n/a
3 TRCN0000056475 GCAGGACTACATCGACAGGAT pLKO.1 1588 CDS 100% 2.640 2.112 N RAB11FIP3 n/a
4 TRCN0000056473 GCAGAAGCTGTTGGATGAGAT pLKO.1 1114 CDS 100% 4.950 3.465 N RAB11FIP3 n/a
5 TRCN0000187717 GAAGAGCATTGAGATCGAGAA pLKO.1 994 CDS 100% 4.050 2.835 N Rab11fip3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011522764.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.