Transcript: Human XM_011522775.3

PREDICTED: Homo sapiens telomere maintenance 2 (TELO2), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
TELO2 (9894)
Length:
3485
CDS:
263..2962

Additional Resources:

NCBI RefSeq record:
XM_011522775.3
NBCI Gene record:
TELO2 (9894)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011522775.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000243094 TAGTGCAGCCAGTCCGCTAAA pLKO_005 3122 3UTR 100% 10.800 15.120 N TELO2 n/a
2 TRCN0000243093 TGACCACGTCTGAGGACATAG pLKO_005 1827 CDS 100% 10.800 15.120 N TELO2 n/a
3 TRCN0000243091 AGAACAAGAAGGCCCAGTTTG pLKO_005 1134 CDS 100% 10.800 7.560 N TELO2 n/a
4 TRCN0000243090 ATCTGACCTCACAGTTCTATG pLKO_005 2043 CDS 100% 10.800 7.560 N TELO2 n/a
5 TRCN0000243092 CCTGATGTGCCTGGCTGTTAA pLKO_005 2647 CDS 100% 13.200 7.920 N TELO2 n/a
6 TRCN0000172705 GAACAAGAAGGCCCAGTTTGT pLKO.1 1135 CDS 100% 4.950 2.970 N TELO2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011522775.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.