Transcript: Human XM_011522885.3

PREDICTED: Homo sapiens brain expressed associated with NEDD4 1 (BEAN1), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
BEAN1 (146227)
Length:
2486
CDS:
60..569

Additional Resources:

NCBI RefSeq record:
XM_011522885.3
NBCI Gene record:
BEAN1 (146227)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011522885.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000256375 ATGAAGGGCTAAGACTATTTA pLKO_005 1970 3UTR 100% 15.000 10.500 N BEAN1 n/a
2 TRCN0000256377 ACCCTACTCGCTGACTGATTC pLKO_005 290 CDS 100% 10.800 7.560 N BEAN1 n/a
3 TRCN0000256376 TCAGGGAGCTGTACCCAGATT pLKO_005 199 CDS 100% 4.950 3.465 N BEAN1 n/a
4 TRCN0000265793 TCTGGCCCAGAGAGGATTGTG pLKO_005 546 CDS 100% 1.650 1.155 N BEAN1 n/a
5 TRCN0000256374 TTCACACGGTCTCCATGGACA pLKO_005 403 CDS 100% 2.640 1.584 N BEAN1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011522885.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.