Transcript: Human XM_011522912.2

PREDICTED: Homo sapiens zinc finger protein, FOG family member 1 (ZFPM1), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ZFPM1 (161882)
Length:
7090
CDS:
3745..6903

Additional Resources:

NCBI RefSeq record:
XM_011522912.2
NBCI Gene record:
ZFPM1 (161882)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011522912.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000438348 GTTCCTTCCGCAGTACGTGTT pLKO_005 5454 CDS 100% 4.050 5.670 N ZFPM1 n/a
2 TRCN0000425325 GCCGTCTTTGCAACATCAAGT pLKO_005 6809 CDS 100% 4.950 3.960 N ZFPM1 n/a
3 TRCN0000107405 CACCTTCAGCAACGTCAACAA pLKO.1 5634 CDS 100% 4.950 3.465 N ZFPM1 n/a
4 TRCN0000107409 CCACTTGGTCACCAACCACAT pLKO.1 4977 CDS 100% 4.050 2.835 N ZFPM1 n/a
5 TRCN0000107408 ACAGAGATCCACAGGAAGGAT pLKO.1 4369 CDS 100% 3.000 2.100 N ZFPM1 n/a
6 TRCN0000107407 CGAGACCTACACCGTGCACAA pLKO.1 5967 CDS 100% 1.350 0.945 N ZFPM1 n/a
7 TRCN0000107406 GCCACCGCAGTGATCAACAAA pLKO.1 4576 CDS 100% 5.625 3.375 N ZFPM1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011522912.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.