Transcript: Human XM_011523008.2

PREDICTED: Homo sapiens telomere repeat binding bouquet formation protein 1 (TERB1), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
TERB1 (283847)
Length:
2882
CDS:
133..2316

Additional Resources:

NCBI RefSeq record:
XM_011523008.2
NBCI Gene record:
TERB1 (283847)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011523008.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000136762 CCGTTAAAGAGCGCAAATCCA pLKO.1 1612 CDS 100% 3.000 4.200 N TERB1 n/a
2 TRCN0000136473 CCACATGCTAATGAATGGCTA pLKO.1 742 CDS 100% 2.640 3.696 N TERB1 n/a
3 TRCN0000135756 CCTGAGATAATTCGCCCTATT pLKO.1 778 CDS 100% 10.800 7.560 N TERB1 n/a
4 TRCN0000133985 CAAGTGAACATAGCATGGTAA pLKO.1 338 CDS 100% 4.950 3.465 N TERB1 n/a
5 TRCN0000134141 CACAGAATAGAACAGCTTGAA pLKO.1 1369 CDS 100% 4.950 3.465 N TERB1 n/a
6 TRCN0000135177 CCGAAACTTTAGCAAGCTCTT pLKO.1 1944 CDS 100% 4.050 2.835 N TERB1 n/a
7 TRCN0000136076 GACCAAATGAAGACACCGTTA pLKO.1 1597 CDS 100% 4.050 2.835 N TERB1 n/a
8 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 24 5UTR 100% 5.625 2.813 Y KLHL30 n/a
9 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 24 5UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011523008.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.