Transcript: Human XM_011523616.2

PREDICTED: Homo sapiens MYB binding protein 1a (MYBBP1A), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
MYBBP1A (10514)
Length:
4552
CDS:
811..4041

Additional Resources:

NCBI RefSeq record:
XM_011523616.2
NBCI Gene record:
MYBBP1A (10514)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011523616.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000434023 ATCTGCCTGAGACGCCTATTT pLKO_005 4076 3UTR 100% 13.200 18.480 N MYBBP1A n/a
2 TRCN0000415855 CTCAAAGCCGACTTGAATATA pLKO_005 644 5UTR 100% 15.000 10.500 N MYBBP1A n/a
3 TRCN0000422145 CTCTCTTTGCAAACCTGTTTG pLKO_005 438 5UTR 100% 10.800 7.560 N MYBBP1A n/a
4 TRCN0000428909 GTGGGATCCGTGAACCTATTC pLKO_005 740 5UTR 100% 10.800 7.560 N MYBBP1A n/a
5 TRCN0000020927 AGCACCAACAACCAGAAGAAA pLKO.1 1330 CDS 100% 5.625 3.938 N MYBBP1A n/a
6 TRCN0000020928 GAGACGAAGAAGCGCAAGAAA pLKO.1 3583 CDS 100% 5.625 3.938 N MYBBP1A n/a
7 TRCN0000020925 CCACTCGTTCTTTGTCACAAA pLKO.1 1497 CDS 100% 4.950 3.465 N MYBBP1A n/a
8 TRCN0000020926 CGAGATGAAATATGCCCTGAA pLKO.1 247 5UTR 100% 4.050 2.835 N MYBBP1A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011523616.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.