Transcript: Human XM_011523680.2

PREDICTED: Homo sapiens phosphoinositide-3-kinase regulatory subunit 6 (PIK3R6), transcript variant X5, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PIK3R6 (146850)
Length:
2828
CDS:
254..2443

Additional Resources:

NCBI RefSeq record:
XM_011523680.2
NBCI Gene record:
PIK3R6 (146850)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011523680.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000107181 CCAGATCTACACAGTCAAGAT pLKO.1 1738 CDS 100% 4.950 6.930 N PIK3R6 n/a
2 TRCN0000107180 GCCGAACAGAACTTGACGAAT pLKO.1 671 CDS 100% 4.950 6.930 N PIK3R6 n/a
3 TRCN0000107182 GTCCGCATTCTTCTCAGAGAA pLKO.1 413 CDS 100% 4.950 3.465 N PIK3R6 n/a
4 TRCN0000107184 AGGTGAAGATCCAAGATTCTA pLKO.1 1815 CDS 100% 5.625 3.375 N PIK3R6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011523680.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.