Transcript: Human XM_011523954.3

PREDICTED: Homo sapiens nuclear cap binding subunit 3 (NCBP3), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
NCBP3 (55421)
Length:
2682
CDS:
288..1844

Additional Resources:

NCBI RefSeq record:
XM_011523954.3
NBCI Gene record:
NCBP3 (55421)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011523954.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000419445 AGATATCATTCCCGTCGTATT pLKO_005 849 CDS 100% 10.800 15.120 N NCBP3 n/a
2 TRCN0000036908 CCTCTTCTGATGTGCATAGTA pLKO.1 1489 CDS 100% 5.625 7.875 N NCBP3 n/a
3 TRCN0000036904 CGTCGTATAAACATCGACATT pLKO.1 922 CDS 100% 4.950 6.930 N NCBP3 n/a
4 TRCN0000336336 GTTGGCTTGACGTCGTATAAA pLKO_005 912 CDS 100% 15.000 12.000 N Ncbp3 n/a
5 TRCN0000414387 GTTCCCAGGCAGGATAGTAAA pLKO_005 1518 CDS 100% 13.200 9.240 N NCBP3 n/a
6 TRCN0000433799 CATGAGGGCAGATAGTGTATC pLKO_005 1262 CDS 100% 10.800 7.560 N NCBP3 n/a
7 TRCN0000036907 CGGGAGAAGAAATCAGGTAAT pLKO.1 1557 CDS 100% 10.800 7.560 N NCBP3 n/a
8 TRCN0000198862 GACCGAGACATGATGAAGAAA pLKO.1 279 5UTR 100% 5.625 3.938 N Ncbp3 n/a
9 TRCN0000036905 CGACATCTATTAGATGAGAAA pLKO.1 1344 CDS 100% 4.950 3.465 N NCBP3 n/a
10 TRCN0000087583 AGGAGGAAGAGGAAGAGGAAA pLKO.1 997 CDS 100% 4.950 2.475 Y Adam32 n/a
11 TRCN0000156756 GAGGAAGAGGAAGAGGAAGAT pLKO.1 999 CDS 100% 4.950 2.475 Y NPM2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011523954.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.