Transcript: Human XM_011524198.3

PREDICTED: Homo sapiens amyloid beta precursor protein binding protein 2 (APPBP2), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
APPBP2 (10513)
Length:
6226
CDS:
295..1794

Additional Resources:

NCBI RefSeq record:
XM_011524198.3
NBCI Gene record:
APPBP2 (10513)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011524198.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000298620 CCATTGGAAATTACGAGAAAG pLKO_005 1613 CDS 100% 10.800 8.640 N APPBP2 n/a
2 TRCN0000293907 CTGTAGGAATAAGCATATATT pLKO_005 1953 3UTR 100% 15.000 10.500 N APPBP2 n/a
3 TRCN0000293906 TCTGATACACTGCTAGATTAT pLKO_005 898 CDS 100% 13.200 9.240 N APPBP2 n/a
4 TRCN0000065280 GCTGAAGAAATGCACATCAAA pLKO.1 1378 CDS 100% 5.625 3.938 N APPBP2 n/a
5 TRCN0000286470 GCTGAAGAAATGCACATCAAA pLKO_005 1378 CDS 100% 5.625 3.938 N APPBP2 n/a
6 TRCN0000065282 CGGCAATATTCAGTGACAGAT pLKO.1 1681 CDS 100% 4.950 3.465 N APPBP2 n/a
7 TRCN0000065281 CGGTGCTCTTATATAGCAGAA pLKO.1 346 CDS 100% 4.050 2.835 N APPBP2 n/a
8 TRCN0000065278 CCAGTGAAAGTTGTGGTGGAT pLKO.1 757 CDS 100% 2.640 1.848 N APPBP2 n/a
9 TRCN0000286471 CCAGTGAAAGTTGTGGTGGAT pLKO_005 757 CDS 100% 2.640 1.848 N APPBP2 n/a
10 TRCN0000065279 CCCGAGAACATCCAGTTTGAT pLKO.1 113 5UTR 100% 5.625 3.375 N APPBP2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011524198.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.