Transcript: Human XM_011524414.1

PREDICTED: Homo sapiens keratin 25 (KRT25), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
KRT25 (147183)
Length:
1656
CDS:
56..1402

Additional Resources:

NCBI RefSeq record:
XM_011524414.1
NBCI Gene record:
KRT25 (147183)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011524414.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000424209 AGACCTACTGTCTCCTTATAG pLKO_005 1191 CDS 100% 13.200 9.240 N KRT25 n/a
2 TRCN0000116493 CCAGCTTTGGTACTGGAAATT pLKO.1 132 CDS 100% 13.200 9.240 N KRT25 n/a
3 TRCN0000423268 CAGATCTGGAGATTCAGTATG pLKO_005 651 CDS 100% 10.800 7.560 N KRT25 n/a
4 TRCN0000420550 CTGGATCACTCAGACTCTATG pLKO_005 102 CDS 100% 10.800 7.560 N KRT25 n/a
5 TRCN0000428471 GTGTAGAGGCTGATGTCAATG pLKO_005 591 CDS 100% 10.800 7.560 N KRT25 n/a
6 TRCN0000116495 CCAGGCTTACAGCTGATGATT pLKO.1 531 CDS 100% 5.625 3.938 N KRT25 n/a
7 TRCN0000116496 CCCGGAATGAGCTGACTGAAA pLKO.1 933 CDS 100% 4.950 3.465 N KRT25 n/a
8 TRCN0000116492 GCATTATGTATCTGTCCAGAA pLKO.1 1452 3UTR 100% 4.050 2.835 N KRT25 n/a
9 TRCN0000116494 GCCATAGTGGTTAAGAAAGTT pLKO.1 1304 CDS 100% 5.625 3.375 N KRT25 n/a
10 TRCN0000420666 TGACCATGCAGAACCTCAATG pLKO_005 291 CDS 100% 10.800 5.400 Y KRT16 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011524414.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.