Transcript: Human XM_011524433.2

PREDICTED: Homo sapiens ankyrin repeat and fibronectin type III domain containing 1 (ANKFN1), transcript variant X13, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ANKFN1 (162282)
Length:
8645
CDS:
379..2898

Additional Resources:

NCBI RefSeq record:
XM_011524433.2
NBCI Gene record:
ANKFN1 (162282)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011524433.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000432245 GTTTACTATGAGCCCATTAAA pLKO_005 1045 CDS 100% 15.000 21.000 N ANKFN1 n/a
2 TRCN0000419500 CTGTAGCTCTGTGGATCAAAT pLKO_005 1302 CDS 100% 13.200 18.480 N ANKFN1 n/a
3 TRCN0000007316 CGGCTTACAATATGAAAGGAT pLKO.1 491 CDS 100% 3.000 4.200 N ANKFN1 n/a
4 TRCN0000435622 TTATATCTGGGTTACCTAAAG pLKO_005 1279 CDS 100% 10.800 7.560 N ANKFN1 n/a
5 TRCN0000007317 CGACATGGAAACATACTCATA pLKO.1 1069 CDS 100% 4.950 3.465 N ANKFN1 n/a
6 TRCN0000190475 GCCCATCACTAAGCTGATAGA pLKO.1 1968 CDS 100% 4.950 3.465 N n/a
7 TRCN0000007319 GCTGAGGCAAAGCATACCAAT pLKO.1 927 CDS 100% 4.950 3.465 N ANKFN1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011524433.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.