Transcript: Human XM_011524491.3

PREDICTED: Homo sapiens LYR motif containing 9 (LYRM9), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
LYRM9 (201229)
Length:
4610
CDS:
3077..3433

Additional Resources:

NCBI RefSeq record:
XM_011524491.3
NBCI Gene record:
LYRM9 (201229)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011524491.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000264107 TTGAATCCCAGATGCAATAAG pLKO_005 3868 3UTR 100% 13.200 18.480 N LYRM9 n/a
2 TRCN0000264106 ACTGCAGCTCTACCGATACTT pLKO_005 3193 CDS 100% 5.625 7.875 N LYRM9 n/a
3 TRCN0000264108 GCATGCTGTCAGGCAGAGTTT pLKO_005 3265 CDS 100% 4.950 6.930 N LYRM9 n/a
4 TRCN0000264109 AGAGAATCCAGCAGATTATTA pLKO_005 3315 CDS 100% 15.000 10.500 N LYRM9 n/a
5 TRCN0000267854 GAGAGAATCCAGCAGATTATT pLKO_005 3314 CDS 100% 15.000 10.500 N Lyrm9 n/a
6 TRCN0000264105 CTGACTGGATCATGAACAAAT pLKO_005 3354 CDS 100% 13.200 9.240 N LYRM9 n/a
7 TRCN0000346204 CATGCTGTCAGGCAGAGTTTC pLKO_005 3266 CDS 100% 10.800 7.560 N Lyrm9 n/a
8 TRCN0000256748 GGCAGGAGAATTGCTTGAATC pLKO_005 2810 5UTR 100% 10.800 5.400 Y SMIM11A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011524491.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.