Transcript: Human XM_011524703.1

PREDICTED: Homo sapiens acetyl-CoA carboxylase alpha (ACACA), transcript variant X5, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ACACA (31)
Length:
9541
CDS:
177..7217

Additional Resources:

NCBI RefSeq record:
XM_011524703.1
NBCI Gene record:
ACACA (31)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011524703.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000232456 TACAAGGGATACAGGTATTTA pLKO_005 5409 CDS 100% 15.000 21.000 N ACACA n/a
2 TRCN0000232455 TATGAGGTGGATCGGAGATTT pLKO_005 4200 CDS 100% 13.200 18.480 N ACACA n/a
3 TRCN0000232458 TTGGACGGAGACCGCCATATT pLKO_005 9390 3UTR 100% 13.200 18.480 N ACACA n/a
4 TRCN0000004767 CCAGCACTCTCGATTCATAAT pLKO.1 218 CDS 100% 13.200 10.560 N ACACA n/a
5 TRCN0000029026 CGGACCAATATGGCAATGCTA pLKO.1 1267 CDS 100% 3.000 2.400 N ACACA n/a
6 TRCN0000232457 GAATCCTCATTGGCCTATAAT pLKO_005 5592 CDS 100% 15.000 10.500 N ACACA n/a
7 TRCN0000232454 GTATGTTCGAAGGGCTTATAT pLKO_005 3632 CDS 100% 15.000 10.500 N ACACA n/a
8 TRCN0000029024 GCCTTCCAGATCCTTTCTTTA pLKO.1 2779 CDS 100% 13.200 9.240 N ACACA n/a
9 TRCN0000029025 CGGGAAGTCTTCTTTATGAAT pLKO.1 3048 CDS 100% 5.625 3.938 N ACACA n/a
10 TRCN0000004765 CCCACCAAATTATGACACAAA pLKO.1 9169 3UTR 100% 4.950 3.465 N ACACA n/a
11 TRCN0000029028 CGTCTCTTTATGATGAGGATA pLKO.1 3991 CDS 100% 4.950 3.465 N ACACA n/a
12 TRCN0000004769 CTGCTTCTGTTGGCTCAGATA pLKO.1 328 CDS 100% 4.950 3.465 N ACACA n/a
13 TRCN0000029027 GCAGCTACATTGAACCGGAAA pLKO.1 3021 CDS 100% 4.050 2.835 N ACACA n/a
14 TRCN0000004766 GCTCAGATACACTCTCTGATT pLKO.1 340 CDS 100% 0.495 0.347 N ACACA n/a
15 TRCN0000004768 CTACTCAGACAGTAAGAATTA pLKO.1 124 5UTR 100% 13.200 7.920 N ACACA n/a
16 TRCN0000028934 CCTGTGTGTTTGAGAAGGAAA pLKO.1 2401 CDS 100% 4.950 2.970 N Acaca n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011524703.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.