Transcript: Human XM_011524781.2

PREDICTED: Homo sapiens potassium inwardly rectifying channel subfamily J member 16 (KCNJ16), transcript variant X7, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
KCNJ16 (3773)
Length:
4106
CDS:
586..1842

Additional Resources:

NCBI RefSeq record:
XM_011524781.2
NBCI Gene record:
KCNJ16 (3773)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011524781.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000428509 AGGCGAGACGAAGGTCATTTA pLKO_005 1688 CDS 100% 13.200 18.480 N KCNJ16 n/a
2 TRCN0000412472 CAAATTAGTCAACGACCAAAT pLKO_005 1299 CDS 100% 10.800 15.120 N KCNJ16 n/a
3 TRCN0000044660 CCTTTCATCATGGCGATCTAT pLKO.1 872 CDS 100% 5.625 7.875 N KCNJ16 n/a
4 TRCN0000044658 CCGGTAACTATTGTCCATGAA pLKO.1 1333 CDS 100% 4.950 6.930 N KCNJ16 n/a
5 TRCN0000044659 CCACACATGAATATAGGGAAA pLKO.1 1763 CDS 100% 4.050 5.670 N KCNJ16 n/a
6 TRCN0000044661 GCCAAAGATAACTTTGAGATT pLKO.1 1399 CDS 100% 0.495 0.347 N KCNJ16 n/a
7 TRCN0000044662 GCTGTGTTACTGAAGAATGTT pLKO.1 995 CDS 100% 5.625 3.375 N KCNJ16 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011524781.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.