Transcript: Human XM_011524810.2

PREDICTED: Homo sapiens lactoperoxidase (LPO), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
LPO (4025)
Length:
2454
CDS:
551..1930

Additional Resources:

NCBI RefSeq record:
XM_011524810.2
NBCI Gene record:
LPO (4025)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011524810.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000045994 GCAGACACTAGAGGAGTTGAA pLKO.1 1525 CDS 100% 4.950 3.960 N LPO n/a
2 TRCN0000045995 CCAAGCTGATGAAACAGAATA pLKO.1 1353 CDS 100% 13.200 9.240 N LPO n/a
3 TRCN0000045996 GACCACATGCAGAAGTGGATA pLKO.1 1097 CDS 100% 4.950 3.465 N LPO n/a
4 TRCN0000416900 AGTCTTGGCCCTTAACCTTTA pLKO_005 2217 3UTR 100% 10.800 6.480 N LPO n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011524810.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.