Transcript: Human XM_011524870.2

PREDICTED: Homo sapiens UTP18 small subunit processome component (UTP18), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
UTP18 (51096)
Length:
2175
CDS:
29..1573

Additional Resources:

NCBI RefSeq record:
XM_011524870.2
NBCI Gene record:
UTP18 (51096)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011524870.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000140364 GCAGAGACTACTAAGCGGAAA pLKO.1 617 CDS 100% 4.050 5.670 N UTP18 n/a
2 TRCN0000145055 CAGCAAGGTTCTTTATGTCTA pLKO.1 976 CDS 100% 4.950 3.465 N UTP18 n/a
3 TRCN0000122391 GAGAAGATAGTGAGGAGCTTT pLKO.1 1049 CDS 100% 4.950 3.465 N UTP18 n/a
4 TRCN0000144750 GCTGGATTAGATAATGCTGTA pLKO.1 833 CDS 100% 4.050 2.835 N UTP18 n/a
5 TRCN0000145156 GCTGTATCACTATTTCAGGTT pLKO.1 848 CDS 100% 2.640 1.848 N UTP18 n/a
6 TRCN0000140229 GTGAACTCAAGGAAGTGCCTT pLKO.1 1259 CDS 100% 2.640 1.848 N UTP18 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011524870.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.