Transcript: Human XM_011524915.2

PREDICTED: Homo sapiens sidekick cell adhesion molecule 2 (SDK2), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SDK2 (54549)
Length:
10779
CDS:
387..6794

Additional Resources:

NCBI RefSeq record:
XM_011524915.2
NBCI Gene record:
SDK2 (54549)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011524915.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000179531 GAACTCTTTCTGCCGAAAGAA pLKO.1 6389 CDS 100% 0.563 0.450 N SDK2 n/a
2 TRCN0000184059 CCAGCTATCACTTGGCAGAAA pLKO.1 1677 CDS 100% 4.950 3.465 N SDK2 n/a
3 TRCN0000157773 CCAGTTCATCAACGGCATCAA pLKO.1 2837 CDS 100% 4.950 3.465 N SDK2 n/a
4 TRCN0000184371 GATCCGCTACATTCTGGAGAT pLKO.1 2252 CDS 100% 4.050 2.835 N SDK2 n/a
5 TRCN0000155257 GCCTAACTTTCAAGACAGCAT pLKO.1 2924 CDS 100% 2.640 1.848 N SDK2 n/a
6 TRCN0000157656 GCTCAAGAACTTGACTGGCTA pLKO.1 5444 CDS 100% 2.640 1.848 N SDK2 n/a
7 TRCN0000156719 GCTTACCTCCATGTACTCCAT pLKO.1 5084 CDS 100% 2.640 1.848 N SDK2 n/a
8 TRCN0000120144 CCGCTACATTCTGGAGATGTA pLKO.1 2255 CDS 100% 0.495 0.297 N Pus1 n/a
9 TRCN0000166364 CACACACACACACACACACAA pLKO.1 7638 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011524915.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.