Transcript: Human XM_011525477.1

PREDICTED: Homo sapiens cytohesin 1 (CYTH1), transcript variant X5, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CYTH1 (9267)
Length:
3137
CDS:
75..1094

Additional Resources:

NCBI RefSeq record:
XM_011525477.1
NBCI Gene record:
CYTH1 (9267)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011525477.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000062113 CCGACAATAAAGACCAAGTTA pLKO.1 883 CDS 100% 5.625 7.875 N CYTH1 n/a
2 TRCN0000062116 CCCTTTAGAGAATCTGAGTAT pLKO.1 812 CDS 100% 4.950 6.930 N CYTH1 n/a
3 TRCN0000062115 CGGAATCTCTATGAGAGCATA pLKO.1 594 CDS 100% 4.950 6.930 N CYTH1 n/a
4 TRCN0000110116 CCGGAATCTCTATGAGAGCAT pLKO.1 593 CDS 100% 2.640 3.696 N Cyth1 n/a
5 TRCN0000218516 CATTGCCCAGTTCTTATATAA pLKO_005 185 CDS 100% 15.000 10.500 N CYTH1 n/a
6 TRCN0000230433 GGGTCAGTATTAGTCTATTTA pLKO_005 2895 3UTR 100% 15.000 10.500 N CYTH1 n/a
7 TRCN0000230431 AGGCGTTTGCCCAGCGATATT pLKO_005 394 CDS 100% 13.200 9.240 N CYTH1 n/a
8 TRCN0000062117 GCATGAGTTCACTGATCTTAA pLKO.1 296 CDS 100% 13.200 9.240 N CYTH1 n/a
9 TRCN0000230430 GAGATAGCAGAAGTAGCTAAT pLKO_005 15 5UTR 100% 10.800 7.560 N CYTH1 n/a
10 TRCN0000062114 CCAGCGATATTGTCAGTGCAA pLKO.1 404 CDS 100% 2.640 1.848 N CYTH1 n/a
11 TRCN0000230432 CCATGAACCGAGGCATCAATG pLKO_005 544 CDS 100% 10.800 6.480 N CYTH1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011525477.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.