Transcript: Human XM_011525520.2

PREDICTED: Homo sapiens transmembrane protein 94 (TMEM94), transcript variant X23, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
TMEM94 (9772)
Length:
4788
CDS:
636..4034

Additional Resources:

NCBI RefSeq record:
XM_011525520.2
NBCI Gene record:
TMEM94 (9772)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011525520.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000420767 AGTCGGTGATGCTACACTATG pLKO_005 618 5UTR 100% 10.800 15.120 N TMEM94 n/a
2 TRCN0000412471 ACCATGTGTGAGATGATAAAG pLKO_005 2817 CDS 100% 13.200 10.560 N TMEM94 n/a
3 TRCN0000420536 CCTACGAAGCAGAGGACTTTG pLKO_005 1465 CDS 100% 10.800 7.560 N TMEM94 n/a
4 TRCN0000061863 GCGAGGGATCATTGACCAAAT pLKO.1 172 5UTR 100% 10.800 7.560 N TMEM94 n/a
5 TRCN0000425045 GGATACTCTCAGCAGCTATAC pLKO_005 920 CDS 100% 10.800 7.560 N TMEM94 n/a
6 TRCN0000061864 CCGCTTTGTCTACTTCTCTTT pLKO.1 2420 CDS 100% 4.950 3.465 N TMEM94 n/a
7 TRCN0000061866 GAGCCCTATTCACACCACAAA pLKO.1 1335 CDS 100% 4.950 3.465 N TMEM94 n/a
8 TRCN0000061865 GCTGGTTGAAGGAGACATCAT pLKO.1 331 5UTR 100% 4.950 3.465 N TMEM94 n/a
9 TRCN0000189444 CCATGTATCCAGACCTCCATA pLKO.1 237 5UTR 100% 4.950 2.970 N Tmem94 n/a
10 TRCN0000328561 CCATGTATCCAGACCTCCATA pLKO_005 237 5UTR 100% 4.950 2.970 N Tmem94 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011525520.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.