Transcript: Human XM_011525886.1

PREDICTED: Homo sapiens PH domain and leucine rich repeat protein phosphatase 1 (PHLPP1), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PHLPP1 (23239)
Length:
3604
CDS:
240..3569

Additional Resources:

NCBI RefSeq record:
XM_011525886.1
NBCI Gene record:
PHLPP1 (23239)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011525886.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000349699 GAACTTCCTGCCCGCTTATTT pLKO_005 3030 CDS 100% 15.000 21.000 N PHLPP1 n/a
2 TRCN0000082797 CGAGGTCTTTCCCGAAGTTAT pLKO.1 3524 CDS 100% 13.200 18.480 N PHLPP1 n/a
3 TRCN0000363574 CGAGGTCTTTCCCGAAGTTAT pLKO_005 3524 CDS 100% 13.200 18.480 N PHLPP1 n/a
4 TRCN0000419059 GATCCTTCACATGGCCTATAA pLKO_005 3356 CDS 100% 13.200 9.240 N PHLPP1 n/a
5 TRCN0000082794 CCTGATAGTATCATCTGTGAA pLKO.1 1943 CDS 100% 4.950 3.465 N PHLPP1 n/a
6 TRCN0000327699 CCTGATAGTATCATCTGTGAA pLKO_005 1943 CDS 100% 4.950 3.465 N PHLPP1 n/a
7 TRCN0000082796 CCAGACTTACTACATTTGCTT pLKO.1 2072 CDS 100% 3.000 2.100 N PHLPP1 n/a
8 TRCN0000363573 CCAGACTTACTACATTTGCTT pLKO_005 2072 CDS 100% 3.000 2.100 N PHLPP1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011525886.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.