Transcript: Human XM_011525930.2

PREDICTED: Homo sapiens histocompatibility minor serpin domain containing (HMSD), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
HMSD (284293)
Length:
784
CDS:
245..736

Additional Resources:

NCBI RefSeq record:
XM_011525930.2
NBCI Gene record:
HMSD (284293)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011525930.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000052362 GAAGTCCACAACACGTGTAAA pLKO.1 538 CDS 100% 13.200 18.480 N HMSD n/a
2 TRCN0000424779 ATTCTACCAAGCAACGATAAA pLKO_005 490 CDS 100% 13.200 10.560 N HMSD n/a
3 TRCN0000415602 ACAGATTCCTGTGGCAAATTC pLKO_005 473 CDS 100% 13.200 9.240 N HMSD n/a
4 TRCN0000052361 CAGTCACTTCTTGTTGCAATT pLKO.1 371 CDS 100% 10.800 7.560 N HMSD n/a
5 TRCN0000052358 CTGACACTGAATATGTGCTTA pLKO.1 399 CDS 100% 4.950 3.465 N HMSD n/a
6 TRCN0000436207 TAAACTCCTGGGTTGCTGATA pLKO_005 555 CDS 100% 4.950 3.465 N HMSD n/a
7 TRCN0000052360 CTTATGATTTCCTCACAGGTT pLKO.1 450 CDS 100% 2.640 1.848 N HMSD n/a
8 TRCN0000435545 GAATGATACAGAGAAGTCCAC pLKO_005 526 CDS 100% 2.160 1.512 N HMSD n/a
9 TRCN0000414847 GATGGAGATATTCATCGAGGT pLKO_005 347 CDS 100% 2.160 1.512 N HMSD n/a
10 TRCN0000052359 AGCTAGACTTTGTGAATGATA pLKO.1 513 CDS 100% 5.625 3.375 N HMSD n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011525930.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.