Transcript: Human XM_011526099.2

PREDICTED: Homo sapiens KIAA1328 (KIAA1328), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
KIAA1328 (57536)
Length:
6512
CDS:
354..2060

Additional Resources:

NCBI RefSeq record:
XM_011526099.2
NBCI Gene record:
KIAA1328 (57536)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011526099.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000282926 ACTAGCATCCTGTTACGTATT pLKO_005 2174 3UTR 100% 10.800 15.120 N KIAA1328 n/a
2 TRCN0000264138 TAAGCCTACTCCTAGTCAATG pLKO_005 1112 CDS 100% 10.800 15.120 N KIAA1328 n/a
3 TRCN0000264137 CAGAATCCCTTATAGCATTTA pLKO_005 925 CDS 100% 13.200 9.240 N KIAA1328 n/a
4 TRCN0000264139 AGTTGGGTTTCATTCGCATAT pLKO_005 1664 CDS 100% 10.800 7.560 N KIAA1328 n/a
5 TRCN0000173021 CGTGGTGGAAACCATTGCATA pLKO.1 2333 3UTR 100% 4.950 3.465 N KIAA1328 n/a
6 TRCN0000264136 GGAACATCATCATCTATTAAA pLKO_005 1593 CDS 100% 15.000 9.000 N KIAA1328 n/a
7 TRCN0000088927 GCAGCAAGACTTCTAAAGGAA pLKO.1 5950 3UTR 100% 3.000 2.100 N Wnt2b n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011526099.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.