Transcript: Human XM_011526350.2

PREDICTED: Homo sapiens CEA cell adhesion molecule 4 (CEACAM4), transcript variant X21, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CEACAM4 (1089)
Length:
1120
CDS:
112..846

Additional Resources:

NCBI RefSeq record:
XM_011526350.2
NBCI Gene record:
CEACAM4 (1089)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011526350.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000157282 GTTACGACTCTGACCAAGCAA pLKO.1 494 CDS 100% 3.000 2.400 N CEACAM4 n/a
2 TRCN0000158213 CACCACTGTCCAGTTCACTAT pLKO.1 204 CDS 100% 4.950 3.465 N CEACAM4 n/a
3 TRCN0000153740 CTGGCCTGCAATATTTCAGAA pLKO.1 271 CDS 100% 4.950 3.465 N CEACAM4 n/a
4 TRCN0000156949 GCAGAGGGAAAGGATGTTCTT pLKO.1 247 CDS 100% 4.950 3.465 N CEACAM4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011526350.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.