Transcript: Human XM_011526397.3

PREDICTED: Homo sapiens CLK4 associating serine/arginine rich protein (CLASRP), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CLASRP (11129)
Length:
2264
CDS:
738..2153

Additional Resources:

NCBI RefSeq record:
XM_011526397.3
NBCI Gene record:
CLASRP (11129)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011526397.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000075090 CCCGATACAGTCGAGAATACA pLKO.1 2077 CDS 100% 5.625 7.875 N CLASRP n/a
2 TRCN0000075091 GCGGAGAGAGTTTCGGGAGAA pLKO.1 860 CDS 100% 1.350 1.890 N CLASRP n/a
3 TRCN0000298170 GCGGAGAGAGTTTCGGGAGAA pLKO_005 860 CDS 100% 1.350 1.890 N CLASRP n/a
4 TRCN0000298545 GAGCGGAGACGGGAGTATTAT pLKO_005 136 5UTR 100% 15.000 10.500 N CLASRP n/a
5 TRCN0000293730 AGAAGGCTTCCATCGGTTATA pLKO_005 542 5UTR 100% 13.200 9.240 N CLASRP n/a
6 TRCN0000075088 CCAGATCTACATTGATGAGTT pLKO.1 468 5UTR 100% 4.950 3.465 N CLASRP n/a
7 TRCN0000075089 CAACAACATGATTGACCGATT pLKO.1 285 5UTR 100% 4.050 2.835 N CLASRP n/a
8 TRCN0000286220 CAACAACATGATTGACCGATT pLKO_005 285 5UTR 100% 4.050 2.835 N CLASRP n/a
9 TRCN0000075092 CCGCGAGGAGAAGATCACGTT pLKO.1 1013 CDS 100% 0.880 0.616 N CLASRP n/a
10 TRCN0000286219 CCGCGAGGAGAAGATCACGTT pLKO_005 1013 CDS 100% 0.880 0.616 N CLASRP n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011526397.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.