Transcript: Human XM_011526859.3

PREDICTED: Homo sapiens solute carrier family 6 member 16 (SLC6A16), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SLC6A16 (28968)
Length:
2843
CDS:
7..2352

Additional Resources:

NCBI RefSeq record:
XM_011526859.3
NBCI Gene record:
SLC6A16 (28968)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011526859.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000038324 CCGCATACATAGGATTCCCTT pLKO.1 2184 CDS 100% 2.640 2.112 N SLC6A16 n/a
2 TRCN0000038328 CATGGGAGAAATGTCCCTTAA pLKO.1 911 CDS 100% 10.800 7.560 N SLC6A16 n/a
3 TRCN0000038327 CCATGATGGTTCATCTTTGTA pLKO.1 2024 CDS 100% 5.625 3.938 N SLC6A16 n/a
4 TRCN0000038325 CGCTGCCATCTACATCTTCAT pLKO.1 675 CDS 100% 4.950 3.465 N SLC6A16 n/a
5 TRCN0000038326 GCCTTTCTCGTGTCTGTGATA pLKO.1 1261 CDS 100% 4.950 3.465 N SLC6A16 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011526859.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.