Transcript: Human XM_011527053.2

PREDICTED: Homo sapiens Ras interacting protein 1 (RASIP1), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
RASIP1 (54922)
Length:
3452
CDS:
15..3239

Additional Resources:

NCBI RefSeq record:
XM_011527053.2
NBCI Gene record:
RASIP1 (54922)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011527053.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000437267 CCACTGAGTTCTTCCGGAAAC pLKO_005 2791 CDS 100% 6.000 8.400 N RASIP1 n/a
2 TRCN0000437581 TCGCTGATGGAACGAGGTCAA pLKO_005 2673 CDS 100% 4.050 5.670 N RASIP1 n/a
3 TRCN0000077903 CAAAGCTTTCTGGGAGTTGTA pLKO.1 3311 3UTR 100% 4.950 3.465 N RASIP1 n/a
4 TRCN0000077905 CAGCTCTGCAATGACTTGGAA pLKO.1 2346 CDS 100% 3.000 2.100 N RASIP1 n/a
5 TRCN0000077906 CCCGAGCTGTTCAAATCCGAA pLKO.1 2716 CDS 100% 2.640 1.848 N RASIP1 n/a
6 TRCN0000222740 GCGCAGCCTCTGTCAAGTCTT pLKO.1 439 CDS 100% 1.650 1.155 N RASIP1 n/a
7 TRCN0000077904 GCTCTGCAATGACTTGGAATT pLKO.1 2348 CDS 100% 0.000 0.000 N RASIP1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011527053.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.