Transcript: Human XM_011527173.2

PREDICTED: Homo sapiens spectrin beta, non-erythrocytic 4 (SPTBN4), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SPTBN4 (57731)
Length:
7320
CDS:
169..7224

Additional Resources:

NCBI RefSeq record:
XM_011527173.2
NBCI Gene record:
SPTBN4 (57731)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011527173.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000426191 AGCCGAAGGCTACTACGATAT pLKO_005 1656 CDS 100% 10.800 15.120 N SPTBN4 n/a
2 TRCN0000091515 CCTGAGGTAAACATCCAGAAT pLKO.1 760 CDS 100% 4.950 3.960 N Sptbn4 n/a
3 TRCN0000413540 GCCTCATCAGCAATCAGAAAT pLKO_005 1157 CDS 100% 13.200 9.240 N SPTBN4 n/a
4 TRCN0000432241 TGAGGTAAACATCCAGAATTT pLKO_005 762 CDS 100% 13.200 9.240 N SPTBN4 n/a
5 TRCN0000430172 AGCTAGTGGAACAGCGCAAAG pLKO_005 3089 CDS 100% 6.000 4.200 N SPTBN4 n/a
6 TRCN0000113937 GCAGCCATGAAGAAACACGAA pLKO.1 1564 CDS 100% 2.640 1.848 N SPTBN4 n/a
7 TRCN0000113940 GTGGTCTCTTTCTACCACTAT pLKO.1 997 CDS 100% 0.495 0.347 N SPTBN4 n/a
8 TRCN0000113938 CGTGGTCTCTTTCTACCACTA pLKO.1 996 CDS 100% 0.405 0.284 N SPTBN4 n/a
9 TRCN0000113939 CCAAGAGATGAACAGCCTGAT pLKO.1 2949 CDS 100% 4.050 2.430 N SPTBN4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011527173.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.