Transcript: Human XM_011527562.2

PREDICTED: Homo sapiens lysine methyltransferase 2B (KMT2B), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
KMT2B (9757)
Length:
8717
CDS:
202..8088

Additional Resources:

NCBI RefSeq record:
XM_011527562.2
NBCI Gene record:
KMT2B (9757)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011527562.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000378548 GAAGGGCATCGGGTGCTATAT pLKO_005 8117 3UTR 100% 13.200 18.480 N KMT2B n/a
2 TRCN0000378668 TGAAGAATATCCGGCAGTTTA pLKO_005 1763 CDS 100% 13.200 18.480 N KMT2B n/a
3 TRCN0000005959 CCAGCACTATAAGTTCCGTTA pLKO.1 7656 CDS 100% 4.050 5.670 N KMT2B n/a
4 TRCN0000005962 CCTGAAGAATATCCGGCAGTT pLKO.1 1761 CDS 100% 4.050 2.835 N KMT2B n/a
5 TRCN0000005961 CCCAGCTATATGAGAAAGGAA pLKO.1 4187 CDS 100% 3.000 2.100 N KMT2B n/a
6 TRCN0000005958 ACCCTCATGTTCAGGGTGGAT pLKO.1 8501 3UTR 100% 0.264 0.185 N KMT2B n/a
7 TRCN0000005960 CGCATGGATGACTTTGATGTA pLKO.1 8142 3UTR 100% 4.950 2.970 N KMT2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011527562.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.