Transcript: Human XM_011527683.3

PREDICTED: Homo sapiens MOB kinase activator 3A (MOB3A), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
MOB3A (126308)
Length:
3570
CDS:
558..1211

Additional Resources:

NCBI RefSeq record:
XM_011527683.3
NBCI Gene record:
MOB3A (126308)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011527683.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000052648 CACTCCGTTTCCCAAGAACTT pLKO.1 980 CDS 100% 4.950 6.930 N MOB3A n/a
2 TRCN0000426566 ATTCTATGTGTTACTAGCAAC pLKO_005 1442 3UTR 100% 4.050 5.670 N MOB3A n/a
3 TRCN0000437928 TGGAACCATCATCCCGCTTCT pLKO_005 1278 3UTR 100% 4.050 5.670 N MOB3A n/a
4 TRCN0000052650 CCCAAGCGCAAGTTTGAGCCA pLKO.1 609 CDS 100% 0.220 0.308 N MOB3A n/a
5 TRCN0000052649 CTACTATTTCGTCAAGGAGTT pLKO.1 1127 CDS 100% 4.050 2.835 N MOB3A n/a
6 TRCN0000052652 CTGAACGACTGGGTGGCTGTT pLKO.1 726 CDS 100% 1.350 0.945 N MOB3A n/a
7 TRCN0000438127 GCTGGCAGGATGAGCATAAGT pLKO_005 856 CDS 100% 5.625 3.375 N MOB3A n/a
8 TRCN0000438289 CGTGAACACCTGCTACAAGCA pLKO_005 1103 CDS 100% 2.640 1.584 N MOB3A n/a
9 TRCN0000052651 GCTGGAGCCACTGAAAGAAAT pLKO.1 1169 CDS 100% 13.200 6.600 Y MOB3A n/a
10 TRCN0000204533 CCTCCCAAAGTGCTGGAATTA pLKO.1 1921 3UTR 100% 13.200 6.600 Y LRRC74B n/a
11 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 2666 3UTR 100% 5.625 2.813 Y KLHL30 n/a
12 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 2666 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011527683.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.