Transcript: Human XM_011527817.2

PREDICTED: Homo sapiens lysine demethylase 4B (KDM4B), transcript variant X5, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
KDM4B (23030)
Length:
5429
CDS:
1025..3337

Additional Resources:

NCBI RefSeq record:
XM_011527817.2
NBCI Gene record:
KDM4B (23030)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011527817.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000381567 GTGCTACTGCAATGCCCTACT pLKO_005 3613 3UTR 100% 4.050 5.670 N KDM4B n/a
2 TRCN0000379460 ACTGAGCAACCTTTGAGATTG pLKO_005 3631 3UTR 100% 10.800 7.560 N KDM4B n/a
3 TRCN0000018016 GTGGAAGCTGAAATGCGTGTA pLKO.1 2587 CDS 100% 4.050 2.835 N KDM4B n/a
4 TRCN0000329963 GTGGAAGCTGAAATGCGTGTA pLKO_005 2587 CDS 100% 4.050 2.835 N KDM4B n/a
5 TRCN0000018013 CCGGCCACATTACCCTCCAAA pLKO.1 2183 CDS 100% 1.650 1.155 N KDM4B n/a
6 TRCN0000329962 CCGGCCACATTACCCTCCAAA pLKO_005 2183 CDS 100% 1.650 1.155 N KDM4B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011527817.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.