Transcript: Human XM_011527884.2

PREDICTED: Homo sapiens KN motif and ankyrin repeat domains 3 (KANK3), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
KANK3 (256949)
Length:
3163
CDS:
443..2908

Additional Resources:

NCBI RefSeq record:
XM_011527884.2
NBCI Gene record:
KANK3 (256949)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011527884.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000438683 TCAACGGAGAGTACGAGAGCT pLKO_005 1860 CDS 100% 2.640 2.112 N KANK3 n/a
2 TRCN0000423043 TGATGTGTGCCAGTGAGTATG pLKO_005 2640 CDS 100% 10.800 7.560 N KANK3 n/a
3 TRCN0000153555 CCTCAAATCCATCATGAAGAA pLKO.1 1774 CDS 100% 4.950 3.465 N KANK3 n/a
4 TRCN0000156778 GAAGGAGAATGCGGTGACAAT pLKO.1 2864 CDS 100% 4.950 3.465 N KANK3 n/a
5 TRCN0000156503 CATGGGTGATGTCAATGCCAA pLKO.1 2494 CDS 100% 2.640 1.848 N KANK3 n/a
6 TRCN0000414539 AGGCTAACACTGGCCGAAGAG pLKO_005 3007 3UTR 100% 1.350 0.945 N KANK3 n/a
7 TRCN0000155863 CTGGACTTCCTCAAGTACATA pLKO.1 578 CDS 100% 5.625 3.375 N KANK3 n/a
8 TRCN0000157972 CAAGTACATAGAGGAGCTGGA pLKO.1 589 CDS 100% 2.160 1.296 N KANK3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011527884.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.