Transcript: Human XM_011528144.1

PREDICTED: Homo sapiens RNA exonuclease 1 homolog (REXO1), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
REXO1 (57455)
Length:
4711
CDS:
131..4279

Additional Resources:

NCBI RefSeq record:
XM_011528144.1
NBCI Gene record:
REXO1 (57455)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011528144.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000074444 GCGCTATCTCAACCTGTTCAT pLKO.1 2587 CDS 100% 4.950 6.930 N REXO1 n/a
2 TRCN0000074446 GCACGTGGTTTATGACACCTT pLKO.1 3415 CDS 100% 2.640 2.112 N REXO1 n/a
3 TRCN0000074443 CAGTGCAATAAATCTCCGGTA pLKO.1 3962 CDS 100% 2.160 1.728 N REXO1 n/a
4 TRCN0000434010 ATGACTTGCACAGCATCTTTC pLKO_005 4334 3UTR 100% 10.800 7.560 N REXO1 n/a
5 TRCN0000074447 AGCAAGAACATCTACCTGAAT pLKO.1 2696 CDS 100% 4.950 3.465 N REXO1 n/a
6 TRCN0000421432 ATGACCCTCTCTCCAACTACT pLKO_005 831 CDS 100% 4.950 3.465 N REXO1 n/a
7 TRCN0000074445 CGACTACCTCAGACAGATCAT pLKO.1 3703 CDS 100% 4.950 3.465 N REXO1 n/a
8 TRCN0000428657 TGATCTGGAAGGTTCGAGAAG pLKO_005 3853 CDS 100% 4.050 2.835 N REXO1 n/a
9 TRCN0000243649 CAACGAGATCGTGGACTACAA pLKO_005 3448 CDS 100% 4.950 2.475 Y REXO1L3P n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011528144.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.