Transcript: Human XM_011528229.1

PREDICTED: Homo sapiens intercellular adhesion molecule 5 (ICAM5), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ICAM5 (7087)
Length:
3074
CDS:
138..2912

Additional Resources:

NCBI RefSeq record:
XM_011528229.1
NBCI Gene record:
ICAM5 (7087)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011528229.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000438438 GGTCAAGGACGTAACGCTAAC pLKO_005 1574 CDS 100% 6.000 8.400 N ICAM5 n/a
2 TRCN0000438003 CAGAGCTTCGTGTCCTATACG pLKO_005 1336 CDS 100% 4.950 6.930 N ICAM5 n/a
3 TRCN0000057809 TGGATGAATCTACCTGCCCAA pLKO.1 2140 CDS 100% 2.160 3.024 N ICAM5 n/a
4 TRCN0000057810 GCTGCCCAGAACGCATTACTT pLKO.1 1627 CDS 100% 5.625 3.938 N ICAM5 n/a
5 TRCN0000057812 GACCAGAATCTGAGTCCTGAT pLKO.1 939 CDS 100% 4.050 2.835 N ICAM5 n/a
6 TRCN0000057808 TCTTGGAAGTTGGCTCGGAAA pLKO.1 850 CDS 100% 4.050 2.835 N ICAM5 n/a
7 TRCN0000057811 CCCAGGAGGAAACTTCACGTT pLKO.1 2417 CDS 100% 2.640 1.848 N ICAM5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011528229.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.