Transcript: Human XM_011528361.2

PREDICTED: Homo sapiens DOT1 like histone lysine methyltransferase (DOT1L), transcript variant X6, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
DOT1L (84444)
Length:
8889
CDS:
312..4658

Additional Resources:

NCBI RefSeq record:
XM_011528361.2
NBCI Gene record:
DOT1L (84444)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011528361.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000236343 CACGTTGAACAAGTGCATTTA pLKO_005 6823 3UTR 100% 13.200 18.480 N DOT1L n/a
2 TRCN0000020210 CCGCAAGAAGAAGCTAAACAA pLKO.1 623 CDS 100% 5.625 7.875 N DOT1L n/a
3 TRCN0000020212 GCAGTGCTCGAATTGAGAGAA pLKO.1 3028 CDS 100% 4.950 3.960 N DOT1L n/a
4 TRCN0000236344 GCCCGCAAGAAGAAGCTAAAC pLKO_005 621 CDS 100% 10.800 7.560 N DOT1L n/a
5 TRCN0000020213 CAGATCAGCATTGTGGAGCTA pLKO.1 1362 CDS 100% 2.640 1.848 N DOT1L n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011528361.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.