Transcript: Human XM_011528542.2

PREDICTED: Homo sapiens phosphatidylinositol glycan anchor biosynthesis class U (PIGU), transcript variant X5, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PIGU (128869)
Length:
1123
CDS:
140..799

Additional Resources:

NCBI RefSeq record:
XM_011528542.2
NBCI Gene record:
PIGU (128869)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011528542.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000413660 GAAGCCTAGTGGTAATCATTT pLKO_005 195 CDS 100% 13.200 18.480 N PIGU n/a
2 TRCN0000128366 GTTTCAGATCAACGTCTTCTT pLKO.1 367 CDS 100% 4.950 6.930 N PIGU n/a
3 TRCN0000129318 CCTGCATCATCATCGTCTGTT pLKO.1 567 CDS 100% 4.950 3.465 N PIGU n/a
4 TRCN0000129146 GTTTATCCAGATCGCTGTCAT pLKO.1 439 CDS 100% 4.950 3.465 N PIGU n/a
5 TRCN0000129213 CCTGAGAAACATCTTTGTCCT pLKO.1 544 CDS 100% 2.640 1.848 N PIGU n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011528542.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.