Transcript: Human XM_011528604.3

PREDICTED: Homo sapiens COMM domain containing 7 (COMMD7), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
COMMD7 (149951)
Length:
1839
CDS:
82..654

Additional Resources:

NCBI RefSeq record:
XM_011528604.3
NBCI Gene record:
COMMD7 (149951)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011528604.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000140245 GCCCAACACAATTACCCTGTA pLKO.1 1324 3UTR 100% 4.050 5.670 N COMMD7 n/a
2 TRCN0000142746 GCTCATAGATATGGAGTGGAA pLKO.1 480 CDS 100% 2.640 3.696 N COMMD7 n/a
3 TRCN0000420345 CATTGCCAATCAGTTCTTAAT pLKO_005 1627 3UTR 100% 13.200 9.240 N COMMD7 n/a
4 TRCN0000430325 AGCCTCCTTCTGGTTCCAAAT pLKO_005 301 CDS 100% 10.800 7.560 N COMMD7 n/a
5 TRCN0000143685 GAGGAGAAAGCCACTTACTTT pLKO.1 388 CDS 100% 5.625 3.938 N COMMD7 n/a
6 TRCN0000143970 CAAATGGTGCTTTGAAGAAGA pLKO.1 317 CDS 100% 4.950 3.465 N COMMD7 n/a
7 TRCN0000122491 CAGAACCAGCATGGAGTGTTT pLKO.1 1121 3UTR 100% 4.950 3.465 N COMMD7 n/a
8 TRCN0000122049 CCCTTCAAAGTTCCAGAGTAA pLKO.1 1453 3UTR 100% 4.950 3.465 N COMMD7 n/a
9 TRCN0000145378 GTTGGTGGTTAAGAAAGGAAA pLKO.1 564 CDS 100% 4.950 3.465 N COMMD7 n/a
10 TRCN0000417017 CTACAGCTTCCTGCACGAGAT pLKO_005 1091 3UTR 100% 4.050 2.835 N COMMD7 n/a
11 TRCN0000145040 GATTTCATAACTCTGGGTCTT pLKO.1 364 CDS 100% 4.050 2.835 N COMMD7 n/a
12 TRCN0000140741 GCGAATTGGAGAAAGTGGGAA pLKO.1 524 CDS 100% 2.640 1.848 N COMMD7 n/a
13 TRCN0000140117 GCGGATTTCATAACTCTGGGT pLKO.1 361 CDS 100% 0.660 0.462 N COMMD7 n/a
14 TRCN0000139009 CCAGGCGGATTTCATAACTCT pLKO.1 357 CDS 100% 3.000 1.800 N COMMD7 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011528604.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.