Transcript: Human XM_011528691.3

PREDICTED: Homo sapiens DLG associated protein 4 (DLGAP4), transcript variant X8, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
DLGAP4 (22839)
Length:
3870
CDS:
1411..2268

Additional Resources:

NCBI RefSeq record:
XM_011528691.3
NBCI Gene record:
DLGAP4 (22839)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011528691.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000128932 CCAACTTTCAAATTGACGCAT pLKO.1 2383 3UTR 100% 2.640 3.696 N DLGAP4 n/a
2 TRCN0000127712 GCAGACAGCATCGAGATTTAT pLKO.1 2221 CDS 100% 15.000 10.500 N DLGAP4 n/a
3 TRCN0000219991 ATCATGCCTAGTGGCGTATAA pLKO.1 942 5UTR 100% 13.200 9.240 N DLGAP4 n/a
4 TRCN0000127813 GCAGGAGGAAAGAAACGATTT pLKO.1 2275 3UTR 100% 10.800 7.560 N DLGAP4 n/a
5 TRCN0000129582 CAGCTACTGATGTCCCAGAAA pLKO.1 1837 CDS 100% 4.950 3.465 N DLGAP4 n/a
6 TRCN0000130641 CGAGGATATCAGCATGAAGTT pLKO.1 1965 CDS 100% 4.950 3.465 N DLGAP4 n/a
7 TRCN0000131169 GCTGTAAGTCATCTGAGAGGA pLKO.1 1463 CDS 100% 2.640 1.848 N DLGAP4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011528691.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.