Transcript: Human XM_011528978.2

PREDICTED: Homo sapiens solute carrier family 17 member 9 (SLC17A9), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SLC17A9 (63910)
Length:
2504
CDS:
457..1407

Additional Resources:

NCBI RefSeq record:
XM_011528978.2
NBCI Gene record:
SLC17A9 (63910)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011528978.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000377351 TCATTCCCACCACGATCTGTT pLKO_005 1718 3UTR 100% 4.950 3.960 N SLC17A9 n/a
2 TRCN0000364998 CACACTGTAGGATGCTTAAAG pLKO_005 1902 3UTR 100% 13.200 9.240 N SLC17A9 n/a
3 TRCN0000148553 CCACAGTGGCATTTCTGTTAA pLKO.1 1152 CDS 100% 13.200 9.240 N SLC17A9 n/a
4 TRCN0000364997 CTGGCAGAGCATCTTCTATTT pLKO_005 642 CDS 100% 13.200 9.240 N SLC17A9 n/a
5 TRCN0000149536 GCACACTGTAGGATGCTTAAA pLKO.1 1901 3UTR 100% 13.200 9.240 N SLC17A9 n/a
6 TRCN0000364957 TCTCTGATCATCTCATCAATC pLKO_005 983 CDS 100% 10.800 7.560 N SLC17A9 n/a
7 TRCN0000147743 CAGTGGCATTTCTGTTAACAT pLKO.1 1155 CDS 100% 5.625 3.938 N SLC17A9 n/a
8 TRCN0000150097 CTCTCTGATCATCTCATCAAT pLKO.1 982 CDS 100% 5.625 3.938 N SLC17A9 n/a
9 TRCN0000377400 TCAACCTTGTGGCCATCATCA pLKO_005 1307 CDS 100% 4.950 3.465 N SLC17A9 n/a
10 TRCN0000147015 CATTTCTGTTAACATCCAGGA pLKO.1 1161 CDS 100% 2.160 1.512 N SLC17A9 n/a
11 TRCN0000376457 CTTCAACCACAGTGGCATTTC pLKO_005 1146 CDS 100% 10.800 6.480 N SLC17A9 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011528978.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.