Transcript: Human XM_011528994.2

PREDICTED: Homo sapiens cadherin 22 (CDH22), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CDH22 (64405)
Length:
3862
CDS:
603..3089

Additional Resources:

NCBI RefSeq record:
XM_011528994.2
NBCI Gene record:
CDH22 (64405)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011528994.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000054329 GCGGGACAACGTCATCAAATA pLKO.1 2591 CDS 100% 13.200 18.480 N CDH22 n/a
2 TRCN0000421002 GATTCTGACCAACGGCATTAA pLKO_005 3292 3UTR 100% 13.200 10.560 N CDH22 n/a
3 TRCN0000054328 CGAATCAGATTTGGACCAGAT pLKO.1 1904 CDS 100% 4.050 3.240 N CDH22 n/a
4 TRCN0000415586 GAAGGCTGTTCACTTACTAAG pLKO_005 3488 3UTR 100% 10.800 7.560 N CDH22 n/a
5 TRCN0000437531 ACACCGAAGCCTACGACATGT pLKO_005 2638 CDS 100% 4.950 3.465 N CDH22 n/a
6 TRCN0000054332 CGTGGGAGAGAACACAGACAT pLKO.1 1517 CDS 100% 4.950 3.465 N CDH22 n/a
7 TRCN0000054330 GCCATCAAGTACACCATCTCA pLKO.1 888 CDS 100% 3.000 2.100 N CDH22 n/a
8 TRCN0000054331 GTCATCAAATACAACGACGAA pLKO.1 2601 CDS 100% 2.640 1.848 N CDH22 n/a
9 TRCN0000094337 CGAGTCGGAGTTCATCATCAA pLKO.1 1052 CDS 100% 4.950 2.970 N Cdh22 n/a
10 TRCN0000094336 GATGAAGACATGCGGGACAAT pLKO.1 2580 CDS 100% 4.950 2.970 N Cdh22 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011528994.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.