Transcript: Human XM_011529585.3

PREDICTED: Homo sapiens neural cell adhesion molecule 2 (NCAM2), transcript variant X8, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
NCAM2 (4685)
Length:
7513
CDS:
84..2141

Additional Resources:

NCBI RefSeq record:
XM_011529585.3
NBCI Gene record:
NCAM2 (4685)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011529585.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000153489 CGTGAGCTACATGTGTAAGAA pLKO.1 2506 3UTR 100% 5.625 7.875 N NCAM2 n/a
2 TRCN0000150872 GATATTCTGAACCGACAGTTT pLKO.1 1609 CDS 100% 4.950 6.930 N NCAM2 n/a
3 TRCN0000152618 GCTGCTTCTTTATTCGGCAAT pLKO.1 1756 CDS 100% 4.050 5.670 N NCAM2 n/a
4 TRCN0000153236 GCTGCCAATAGATTGGGATAT pLKO.1 1593 CDS 100% 10.800 8.640 N NCAM2 n/a
5 TRCN0000152382 GCCAGTTATCTTTAGCAGATA pLKO.1 2658 3UTR 100% 0.495 0.396 N NCAM2 n/a
6 TRCN0000153796 CACTAGGAGAATGTGTGGAAA pLKO.1 1796 CDS 100% 4.950 3.465 N NCAM2 n/a
7 TRCN0000152966 GACAATGACTTTGGACGCTAT pLKO.1 990 CDS 100% 4.050 2.835 N NCAM2 n/a
8 TRCN0000157352 CCTGCATGTGTATGAGTCCTA pLKO.1 2530 3UTR 100% 2.640 1.848 N NCAM2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011529585.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.