Transcript: Human XM_011529607.2

PREDICTED: Homo sapiens ubiquitin associated and SH3 domain containing A (UBASH3A), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
UBASH3A (53347)
Length:
2598
CDS:
543..2123

Additional Resources:

NCBI RefSeq record:
XM_011529607.2
NBCI Gene record:
UBASH3A (53347)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011529607.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000234490 GACACGGGTGTCATCCTAATT pLKO_005 1872 CDS 100% 13.200 18.480 N UBASH3A n/a
2 TRCN0000004486 GAGAGCCCTATTCCAGTACAA pLKO.1 980 CDS 100% 4.950 6.930 N UBASH3A n/a
3 TRCN0000004488 CAATTTAACTAGAGCCTCCTT pLKO.1 758 CDS 100% 2.640 3.696 N UBASH3A n/a
4 TRCN0000234489 AGAGCTGAAAGAGGCAAATTT pLKO_005 1727 CDS 100% 15.000 10.500 N UBASH3A n/a
5 TRCN0000233571 CTACAGGCCAGACCTGAATTT pLKO_005 1415 CDS 100% 13.200 9.240 N UBASH3A n/a
6 TRCN0000234491 GCCACGGTGATGTTGTCATAA pLKO_005 2126 3UTR 100% 13.200 9.240 N UBASH3A n/a
7 TRCN0000010881 CATTATCATCGTGTGGCATTT pLKO.1 1492 CDS 100% 10.800 7.560 N UBASH3A n/a
8 TRCN0000233570 GAGCCCTATTCCAGTACAAAC pLKO_005 982 CDS 100% 10.800 7.560 N UBASH3A n/a
9 TRCN0000004487 TCCATCACTCTTTAGCCATAT pLKO.1 2526 3UTR 100% 10.800 7.560 N UBASH3A n/a
10 TRCN0000004489 CGAGTGGAACCTGGAATCTTT pLKO.1 1653 CDS 100% 5.625 3.938 N UBASH3A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011529607.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.